paulina1128r paulina1128r

08-04-2018
History

contestada

What was a key cause for the rise of fascism in nations such as Italy and Germany

Respuesta :

nytavia nytavia

08-04-2018

The key cause was economic hardship

Answer Link

PlutoRoyal PlutoRoyal

08-04-2018

There were many reasons for the rise of fascism in nations such as Italy and Germany, but perhaps the best one is economic hardship, do you have multiple choice answers to choose from?

Answer Link

Otras preguntas

PLEASE SOMEONE HELP ME!!!!! ILL GIVE BRAINLIEST 1. A model rocket is launched from a roof into a large field. The path of the rocket can be modeled by the equat

During the early 1930s the main goal of the bonus army was to pressure the Hoover administration to

Over the period of one month 159 dogs visited the dog park. Suppose the same number of dogs visited each month for 1 year. How is this total different from the

What are the consequences of moving from underground mining to surface mining? (site 1)

Which of the following sets shows all the numbers from the set {0, 0.5, 1, 2.5, 3} that make the inequality 2a + 3 ≥ 8 true? {2.5, 3} {1, 2.5, 3} {0, 0.5, 1} {0

What is mostly likely elevation of the mountain below

Augustus of Prima Porta connects to the subtheme of

Joaquin used the table to predict the cost of one year of education at a four-year public university. Category Predicted Cost tuition $9,450 room and board $7

What is the last step when supervising detainee operations ssd1?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3