alee0235 alee0235

06-11-2017
Spanish

contestada

A la enfermera __________ trabajar en el hospital. (1 point) Question 3 options: 1) le gusta 2) les gusta 3) nos gusta 4) te gustan

Respuesta :

laura09823 laura09823

06-11-2017

1) le gusta.

Buena suerte!!

Answer Link

aduraelijah06 aduraelijah06

06-11-2017

A la enfermera le gustan trabajar en el hospital. Hope this helps!

Answer Link

Otras preguntas

The native bird population in a city is decreasing at a rate of 10% per year due to industrialization of the area by humans. The population of native birds was

Strange Manufacturing Company is purchasing a production facility at a cost of $21 million. The firm expects the project to generate annual cash flows of $7 mil

An electromagnetic wave has a wavelength of 6.2 x 1014 m. What is the frequency of the wave? O2.0 x 10“ Hz O 4.8 x 10-7 Hz O 1.8 x 1024 Hz O 5.3 x 10-22 Hz

Axion Inc. is a small business started by Robert. As the business grew, he decided to implement new company policies that would ensure that his employees are no

Neurotransmitters transmit ____________ between ____________ , from neurons to glands, from neurons to organs, and from neurons to muscles.

1 1/10 divided by 1 1/5

Why does it take three turns of the Calvin cycle to produce G3P, the initial product of photosynthesis?

Where are you on Earth if you experience each of the following? (Refer to the discussion in Observing the Sky: The Birth of Astronomy as well as this chapter.)

Keep it simple bit help fast ill do somethi g for you in return

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is