mymeIody mymeIody

06-05-2021
Mathematics

contestada

**PLEASE HELP!!*
James threw a ball from the roof of a building. The ball fell 3 feet in the first second, 9 feet in the next second, and 27 feet in the third second. which expression represents the distance the ball fell at the nth second?

a. 3^n
b. 3n
c. n^3
d. 6n-3

Respuesta :

shashenam shashenam

06-05-2021

Answer:

n 3 is the correct answer okay

Answer Link

queen00140 queen00140

06-05-2021

Answer:

6n-3........

Step-by-step explanation:

this is answer

Answer Link

Otras preguntas

pretend that you have to do this 5 excerisez -Yoga -Tai chi -walking -Dancing -Swimming and then answer these questions Do you normally excersize? How did you

Josie is a cross-country runner. she completed a cross-country race 8 hours ago and has been sipping water since then. when she goes to the bathroom, she notice

What part of the immune system does the virus HIV attack and disable?

If i have stress fracture of my radius bone what part of my body i have broken

Which dimension of quality means that a decision should reflect a rational process?

A space probe discovers a planet inhabited by creatures that reproduce with the same hereditary patterns seen in humans. three of the phenotypic characteristics

help me please... Problem: The standard form of a circle is (x-h)2+(y-k)2=r2 and for the parabola, y-k=a(x-h)2. The (h,k) pair will be the center of the circle

during the high middle ages how did pilgrimages for the crusades affect the economy?

Which statements describe Elizabethan drama? Check all that apply. Plays address secular themes. Miracle plays tell the stories of Christian saints. Actors port

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3