dbp080205 dbp080205

09-12-2020
Mathematics

contestada

what is the answer. can someone help me .

what is the answer can someone help me class=

Respuesta :

ananthi ananthi

09-12-2020

Answer:

your photo is not visible for me

Answer Link

rgary0360 rgary0360

09-12-2020

Answer:

54

Step-by-step explanation:

11x=26=180

x=14

8x+p+14=180

p=54

Answer Link

Otras preguntas

During the bank reconciliation process, an accountant identified an error. A check written for $20 to pay a supplier for goods purchased on credit was erroneous

Candida can invade tissue by producing the exoenzymes __________ and __________.

Binding of an RNA binding protein will ________ the stability of the RNA molecule. increase decrease neither increase nor decrease either increase or decrease

The _______ virus is responsible for causing German measles.

During the last two decades of the twentieth century: (A) the poor and the middle-class became worse off, while the rich became significantly richer. (B) there

How does urbanization (paving, etc.) affect runoff and infiltration in a small, previously forested, drainage basin? How does urbanization (paving, etc.) affect

Which one of the following is not an example of a type IV hypersensitivity? latex allergy Contact dermatitis (e.g., contact with poison ivy) a positive tubercul

What happens to the membrane of a vesicle after exocytosis? It leaves the cell. It is disassembled by the cell. It fuses with and becomes part of the plasma mem

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Please show working out, thanks!