logan2438 logan2438

07-05-2019
Mathematics

contestada

How many genders are there?

Respuesta :

cutiebanhof cutiebanhof

07-05-2019

There are 2 genders, male and female

Answer Link

myahgoss myahgoss

07-05-2019

There is two genders transgender our not natural

Answer Link

Otras preguntas

what causes imperialism to start war?what causes nationalism to start war?what is a u-boat? how did german's use of then lead to comflict to the us?why did the

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Which would be the most effective overall method?

What happens when a person living in one of those countries becomes seriously ill or has a bad accident? How far must they travel to see a doctor or go to a hos

personal question: What do you usually feel during a love stage?

**I NEED ANSWER TO GRADUATE PLEASE NO GUESSING + 99 POINTS** Match the definition to the term. 1. to make a borrowed word resemble English in pronunciation, sp

solve for x, 3ax+2b/c =4a

1/2+3/5= what answer

You are trying to persuade an Audience that they should exercise more often

What sports-related risk is associated with thirst? A. bodily injury B. bodily dehydration C. poor weather D. poor sportsmanship