stormz5138 stormz5138

08-02-2024
English

contestada

After he __ the unruly of children, they settled down to study quietly.
a) Disciplined
b) Chastised
c) Rebuked
d) Scolded

Respuesta :

Otras preguntas

2. A deposit of $650 is planned for the end of each year into an account paying 6%/year compounded annually. The deposits were not made for the tenth and eleven

A racquet ball with mass m = 0.256 kg is moving toward the wall at v = 11.8 m/s and at an angle of θ = 29° with respect to the horizontal. The ball makes a perf

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that

NEED HELP ASASP WILL NAME YOU BRAINIEST

there are 12 female students and 18 male students in a class. Which of the following expresses the ratio of female students to male students in the simpliest fo

The membrane potential of a neuron is measured from the inside of the cell relative to the outside. For a newly discovered neuron with properties that are not y

To completely describe the motion of an object, you need A. Position B. Speed C. Direction of motion D. All of the above

5 pois When a mass of hydrogen has enough density, it begins to fuse the hydrogen atoms together. This fusion process creates large amounts of heat and light. W

You decide to save money for your daughter's education which requires a one time payment of $60,000 in 10 years and in pursuit of this you deposit a certain amo

How does a long adjective become a pronoun ? Help asappppppp